Skip to main content

Table 1 The primer sequences and the concentration used in qRT–PCR

From: Glutaminolysis dynamics during astrocytoma progression correlates with tumor aggressiveness

Genes Forward primer (5′–3′) Reverse Primer (5′–3′) Concentration (nM)
GLS CAGGGCAGTTTGCTTTCCAT GAGACCAGCACATCATACCCAT 200
GLSiso1 GCAGAGGGTCATGTTGAAGTTGT GGTGTCCAAAGTGCAGTGCTT 200
GLSiso2 ATCCTCGAAGAGAAGGTGGTGA GCAAGTTCTTGTTGGAGACTTTCA 400
GLS2 ATCCTCGAAGAGAAGGTGGTGA ATGGCTGACAAGGCAAACCT 200
GLUD1 TGGCATACACAATGGAGCGT TCTCAATGGCATTAACATAGGCA 400
GOT1 CTGTGCCCAGTCCTTCTCCA GATGCTCTCAGGTTCTTTTCCAA 400
GOT2 CTTGAGGTTGGAGACCAGTTGAGT GATTGCTGCTGCCATTCTGA 400
GPT2 GGCTTTGGGCAGAGGGAA TCACGCGTACTTCTCCAGGAA 200
HPRT TGAGGATTTGGAAAGGGTGT GAGCACACAGAGGGCTACAA 200
GUSβ AAATACGTGGTTGGAGAGCTCATT CCGAGTGAAGATCCCCTTTTTA 400
TBP AGGATAAGAGAGCCACGAACCA CTTGCTGCCAGTCTGGACTGT 200